Are Instagram & Photography Aesthetically Pointless? | Philosophy Tube ft. PBS Idea Channel
What does philosophy have to say about photography and Instagram? Does art and aesthetics come into it?
Idea Channel Video on #Aesthetic: https://www.youtube.com/watch?v=Q_rQbXlmgHI
Subscribe! http://tinyurl.com/pr99a46
Patreon: http://www.patreon.com/PhilosophyTube
Audible: http://www.audibletrial.com/Philosoph…
FAQ: https://www.facebook.com/PhilosophyTu…
Facebook: https://www.facebook.com/PhilosophyTu…
Twitter: @PhilosophyTube
Email: ollysphilosophychannel@gmail.com
Google+: google.com/+thephilosophytube
realphilosophytube.tumblr.com
Recommended Reading:
Roger Scruton, “Photography and Representation,” in Arguing About Art
William King, “Scruton and Reasons for Looking at Photographs,” in Arguing About Art
Dominic McIver Lopes, “The Aesthetics of Photographic Transparency,” in Arguing About Art
If you or your organisation would like to financially support Philosophy Tube in distributing philosophical knowledge to those who might not otherwise have access to it in exchange for credits on the show, please get in touch!
Music: ‘Chiptune Anthem One,’ ‘My Little Medley,’ ‘ Get What You Need Sans Vocals,’ ‘Digital Leapfrog,’ and ‘The Day I Die – Remastered’ by TechnoAxe – http://tinyurl.com/kkrsfgg
Title Animation by Amitai Angor AA VFX – https://www.youtube.com/dvdangor2011
All Instagram photos appear with the gracious permission of their owners. Any copyrighted material should fall under fair use for educational purposes or commentary, but if you are a copyright holder and believe your material has been used unfairly please get in touch with us and we will be happy to discuss it.

@rateeightx
November 18, 2025 at 4:03 am
3:42 Couldn't the same be said about a painting? If we're taking aesthetic interest in a painting, what says we are aesthetically interested in an object which has some abstract patterns or some appealing colours, and which happens to be a painting, rather than being interested in it simply because it's a painting? If I'm looking at a painting, I probably won't find it any more interesting aesthetically than if the same image was say a photograph, or a digital drawing, or a print. While I may take some interest in it because of the artistic skill required to create it, The same is true of a photo, Having taken photos in the past I can definitely say that some skill is required to make a good photograph, And you can't have just anybody take a photo and have it look just as good.
@Coffeeisnecessarynowpepper
November 18, 2025 at 4:03 am
3:23pm 05/21/2023
@stiofanmacamhalghaidhau765
November 18, 2025 at 4:03 am
the whole surface thing… is the surface of say a painting or a sculpture actually vital to its aesthetics?
@rekall76
November 18, 2025 at 4:03 am
ansel adams' amplification of wilderness/nature by way of high contrast, depth of field, careful consideration of time-of-day for lighting, etc. is something i find very aesthetically interesting
@RTgrl
November 18, 2025 at 4:03 am
bokeh has entered the chat
@bassem500
November 18, 2025 at 4:03 am
Very interesting ideas here. I do disagree a bit when it comes to the filter analogy in celestial photography. It does not predominately relate to art in as much as there is no artist per se involved. A better argument, I find, is to talk about composition of a photograph, as an example of the many aspects of artistic choices made by the photographer/author/artist. There are, of course, photos which are aesthetically pointless… selfies to name one. 😉
@lucascastro2732
November 18, 2025 at 4:03 am
As a photographer myself, my mode of action usually is capturing something that calls my attention in the way that it does so. This is how I understand the relationship between "form and content" in photography: the "content" is the subject of the picture itself, and the "form" is the manner in which I take the picture, as I seek to highlight the given element of reality that called my attention in the first place.
Thus, as a photographer, I believe that I would primarily have an interest on the subject itself. However, when the final product, the picture, is done (and there is a lot of aesthetic zeal in its polishing, as I attempt to uncover whatever is it caught my eye in each picture and bring it to its surface), there's every single element that was eternally frozen by the camera. In other words, the subject of the picture is framed in a specific way, and that framing may reveal certain elements not only about the subject itself, but of the perspective – my perspective – that is imposed over the subject.
And, as you said on the video (if I understood correctly), everything that appears in the final photograph gains a specific relevance. The surroundings in which the subject is photographed in relation to end up playing an expressive relevance in its final aesthetic impact, that is. And that, consequently, may reveal an intentional production of meaning through a specific portrait that uses reality's texture as its materials for aesthetic creation.
@crocutaqueen1311
November 18, 2025 at 4:03 am
Just as a painter chooses to paint a veiw in a painting, a photographer chooses the view they photograph. To photograph a rock, or a bird, or a landscape, or a sunset, chosen instead of any other rock, any other bird or animal, any other point of view… This is curated by the photographer, a moment of an experience that would otherwise not have been payed total attention to, would be effemeral if not chosen to be photographed specifically.
The experience of either is chosen, or curated, and features of the painting or photo are developed or built to express that experience.
The internet as its own filter, the frame that is inherent to the photo, the curation of veiws and of experiences makes photography as intentional, and aestheticly precise as a painting.
Further the intention of displaying these experiences over others, the shareing of these experiences informs that curation, and the experience of the image.
Why do i share pictures of myself in full makeup, dressed, posed, designed, over those pictures i could take that were of me without this aesthetic work?
@jjkthebest
November 18, 2025 at 4:03 am
I'm a bit confused. If taking interest in the photo is actually not taking interest in the photo, but in the style then how is that not true for paintings?
@raisa.cabral
November 18, 2025 at 4:03 am
What would Scruton say about genz and millenials thirst for analogic photography? I mean, we find the experience of creating images through analogical processes in order to post them online something marvelous AND the ways we can play with those processes something amazing. The subject of the image could be ANYTHING, the fact that the image is there because of a physical stage we've built and the chemicals that we used, the history, the infered nostalgia ARE the experience AND infer value to the OBJECT "photo" AND the subject of the photo, in a way that we could not find valuable AS ART before all of it. (e.g: dark academia and cottagecore are more than the way people dress, the experience follows the aesthetic but the aesthetic indicates the bases of the experiences, that will be individual but also will bring the sense of community). The *whole process is part of the experience and what serves as the artistic indicator of it*.
@anthonydelfino6171
November 18, 2025 at 4:03 am
Photography is one of those art forms that even more so than other forms of art, you appreciate more the more you know about photography. If you can understand, especially with traditional photography, how the artist made tweaks to the exposure or focus to certain parts of the image in the dark room, or how they might have cut together negatives to combine photographs, that creates a very interesting work. This is in addition to the preparatory work that some photographs require of setting the right scene and framing before actually pressing the button to take a photograph.
Ultimately photography, like other forms of art, comes in varying levels of complexity, skill, and artistic value. Just like my meeting doodles might be on the same level as someone's instagram selfie when compared to professional graphite drawings or fine art photography.
@kimcoleeppling8177
November 18, 2025 at 4:03 am
So I know I'm about five years late to the discussion here but I was literally struggling to find the words to explain this to my therapist earlier this week and, now that I may have found them, wanted to offer my perspective.
I'm autistic, and cannot fundamentally interact with the world in some of the same ways as allistic people might. Although this drastically changes how I experience practically everything, most of those experiences are difficult or impossible to communicate to others because the languages I speak did not evolve with people like me in mind, and therefore the vocabulary to describe my perception of reality does not exist. As such, I'm unable to communicate many of my experiences to others, and often unable to conceptualize my own perception in the same ways as neurotypical people might. Thus, consider this my disclaimer that I may, by the restrictions imposed upon me by the English language, may be forced to mangle it in a possibly futile attempt to communicate with you. Also, I'm not a philosophy student outside of watching your videos, so please forgive me if I misunderstand or misuse technical vocabulary (or if I start talking like a set theorist because that's how I process things).
My mom (not completely neurotypical, but definitely allistic) has always had strong opinions on the comparative aesthetic value of objects, scenes, surroundings, etc. For example, she may decide that one way of arranging furniture in a room has more aesthetic value than another, or that a desk should be organized in one way over another because its aesthetic value affects the productivity of work conducted at that desk. I, on the other hand, find immeasurable aesthetic value in the vast majority of things, possibly more than 75% of the visual inputs I receive. To her, some things are beautiful and some are not; to me, nearly everything is beautiful from a blank wall to the clutter on my desk to the mass of weeds growing unmanaged in my backyard.
At 6:42 you discuss infrared photographs of objects in space, and at 6:53 say "I think some of these photos are amazingly beautiful, but that aesthetic interest can't just be in the subject because we can't see the subject; it must be in the photo, in virtue of its being a photo of a particular sort." Clearly the aesthetic interest I perceive in the three aforementioned scenes is not innate to the subject, as my mother cannot perceive it, and typically sees the wall as boring or the clutter as ugly. However, many of the scenes I find beauty in but she and others do not are the sorts of things you might see in a photograph. You show pictures of a camera at 2:28, a rack of bottles at 2:40, and a graveyard at 4:39. For most people, these are not scenes whose aesthetic beauty one might marvel at for reasonably longer than a few seconds unless you built the rack by hand or you're just really goth. For me, however, the subject alone is plenty sufficient for stimulating viewing. On the flip side, it is entirely possible to take a photograph of a subject with aesthetic value, but where the photograph lacks it, such as most selfies. There probably exist filters I could apply to even the most beautiful of sunsets to remove its aesthetic value in a photograph if so desired.
Imagine four humans, who I'll call Alex, Blake, Charlie, and Dana. Alex has a mutation to see infrared at a distance and always zoomed in like a telescope, and thus can see the cosmic phenomena such as at 6:50 with their naked eye. Blake has artificial implants replacing their eyes, and sees everything perfectly framed and through your favorite Instagram filter. Charlie is your mom, and has four types of cones in their eyes. Dana has "normal" human vision, but is telepathic so as to have a baseline viewer who can compare the visuals.
Dana sees the night sky as fairly aesthetically pleasing. You have eyes; you know roughly what they see. Charlie is similar, since the fourth cone doesn't change much here. Blake probably sees it as more aesthetically pleasing than Dana because filters and framing lead to that affect. To Alex, however, the night sky is unfathomably beautiful, as they see all of it in the beauty no other human can without the aid of technology. There is no framing or filter for them; this is reality, and that is the reality of the subject. When you show them this photograph, their response is not to marvel at what infrared telescopes can show, but rather to confirm that this is how the world is.
Now imagine showing the four subjects a flower, which Dana confirms is a normal amount of beautiful for a flower when seen through typical human eyes, and considers on par with the night sky for aesthetic value. Charlie, however, sees detailed and intricate patterns with their four types of cones, and Blake sees a cropped and filtered image fit for a gallery display. Alex cannot zoom out enough to properly perceive the flower, and thus finds little to no aesthetic value in it.
Suppose we were to show Dana some photographs of both aforementioned visuals, and ask them to compare the images to what they saw and what everyone else saw. Dana sees most of the pictures as having more aesthetic value than the reality they perceived, as the style affects their perception of the subject. However, they might find Blake's perception comparable to some of the photographs, and are aware that Alex's vision yields much more value in the night sky while Charlie's yields more in the flower. If the vast majority of humans were more like one of the others instead of like Dana, our consideration of the aesthetic value of the subjects might change thusly. Dana sees the telescope as necessary to perceive the beauty Alex naturally does in the cosmic phenomena, but a species all like them would need cameras to properly see flowers as having the aesthetic value Dana does.
My point here is to show that although applying a surface to a subject via photography can change the aesthetic value of the image, so too can the viewer's eyes act like a surface. Even without these extreme differences in ocular facilities, it is easy to find two subjects whose aesthetic value you and your friend, or happy!you and sad!you, disagree on, thus causing the viewer's brain and mental state to act as a surface. I see a rack of wine bottles to have aesthetic value both within a photo or without it, but in different ways. You see it only through the photograph's surface. There likely exist people who see it in neither. I propose that there is no aesthetic value in any subject, and the value found is dependent entirely on how it interacts with the surface through which it is seen. We do not see entirely see the surface, nor the subject; all there is is the interaction between. Because of the surfaces that are your brain, you find the photographs to have aesthetic value not found without the intermediary surfaces of photography. For the graveyard and the rack of bottles, the beauty you see in the surface of photography is the beauty I see in real life. I cannot have strong opinions about how to arrange the furniture because all offered ways convey more beauty to me than I can adequately compare.
Sorry if this is really long and rambly; I don't know entirely what I'm saying yet and didn't edit any of this at all. Also, I fear I may have reinvented "Beauty is in the Eye of the Beholder", but hopefully I at least said something meaningful.
@beginanewt
November 18, 2025 at 4:03 am
What about an image which makes you ask "what kind of person would take a picture of this?"
@dylanrees2966
November 18, 2025 at 4:03 am
I think your old videos are gems. It's a real shame they have so few views 🥺
@krister6160
November 18, 2025 at 4:03 am
Paintings represent; photos mainly record.
@PeaceLoveAndGuns
November 18, 2025 at 4:03 am
H-Town skyline! Represent! <3
@saffodils
November 18, 2025 at 4:03 am
The idea that the photograph is itself valuable (apart from its subject) connects with what I learned studying anthropology. Much of recent anthro has been trying to unlearn the idea that a subjective person can create an objective account of a culture, and a lot of it is about the "framing"—who and what we as observers find important or interesting and how we judge it based on our own cultural standards—in addition to what anthropologists have been able to capture "in the photo" (what rituals and ideas people feel comfortable sharing with us). The model for anthro that I learned involves acknowledging that a picture will never be what it is a picture of, that is, that we will never be able to recreate the people and cultures we study. Instead, we should work to make the picture nuanced and free of harmful stereotypes, and make clear where we suspect our biases have crept in.
On a more general note, I've been watching all the PT videos in order from the beginning bc quarantine, and I was so pleased to get to this one. It was evident that older videos owed a lot to the Idea Channel's aesthetic and style, and it's cool to see a) senpai noticing (beyond the shout-outs they had been doing) and b) the growth of PT into its own show with its own community. Can't wait to get to the more Breadtube-y style eps and see what other cool things this channel gets up to!
@gattoleone1843
November 18, 2025 at 4:03 am
I'm waaaaay late for a comment, but I'm quite new to the channel and I attended to a very interesting history of photography course so I might as well revise what I remember by writing this.
Well, the whole point of photography HAVING to be aesthetically pleasing in the first place comes back from its origin, particularly how it was framed as a scientific invention and tool first of all (both Daguerre and Talbot needed help from a scientist to present their inventions to the public via an academy), therefore being an enemy for, at the time, traditional arts, and later just a way to assist painters. Even Baudelaire (in 1859) claimed it would never be a true art, and that was fair following the standards of that time (mostly art having to be difficult to realise, while photography didn't take a huge amount of time – or studies, which also meant women who weren't allowed into arts academia could just turn to photography and that's an interesting point too – to be decent at, a fundamental re-elaboration of reality, which photography wasn't thought to have and apparently Scruton didn't think either, and it not needing to be supported by an industry, while photography needed a bunch of materials to be made). Because of this, some photographers started trying to make photography fit into the standards of the time in the wave known as pictorialism, which included difficult techniques that altered the final look to make it look more like a painting (ex. Demachy's works), or the first elaborate photomontages which couldn't be accused of being just the collection of reality or easy to make (ex. Rejlander's works). Later on this particular branch would evolve into the idea of photography as some kind of updated painting done with a camera instead of a paint brush, which is, I believe, the most popular view in general (though shared by many relevant names, such as anyone in Group f/64) and the one Scruton might be mostly coming from.
But then, 20th century happened, and especially ready-made art such as Duchamp's works happened, and some argue (esp. my now former teacher, C. Marra) that a whole other branch of photography directly stems from that – one that is separate from the legacy of pictorialism, and values the unique features of photography as an art or of the photography as a conceptual operation instead of trying to conceal them. For instance, praising the detachment and scientific connotation a camera can have was really popular with many, from Sander to Arbus to the Bechers, either as a value in itself, or as a way to create a human connection with the subject beforehand or afterwards, or as a way to shield the photographer from the subject. Or the deliberate way some photographers didn't go out of their way to make their photos look pretty either to prevent the viewer from losing focus from the concept that they meant to convey (ex. early Mapplethorpe production) or give a more intimate, photo-album like feeling (ex. Cahun in a way and Goldin). Or photography as the necessary condition for some body/performance art to exist (ex. Urs, Pane and Vaccari). Or even its role in narrative art (ex. Adam's and Duane).
So overall I feel like one branch of photography and one way of approaching it (neopictorialism) is still somewhat over represented at least online, while the other one (conceptual values first) probably has to be valued more than it currently is.
@badsoup8857
November 18, 2025 at 4:03 am
Even if photos merelly recorded aesthetically pleasing things, they would still have value, because they would show you these things you couldn't or wouldn't have otherwise seen, because who would go all the way over there, wherever the photo was taken, and what if the subject doesn't exist anymore? The photos could end up differing from the subject even without any artistic input. If that was true (it isn't) photos wouldn't be art, but they would still have value. Photos can also have some meaning and symbolism, so even without visual transformation, the photo could add value to the subject. I could use the fact that it was recorded or something else exclusive to a photo to do this.
@dichotomae
November 18, 2025 at 4:03 am
paused at 5:19 because the book in the background (philosophies of art & beauty) is literally on my desk next to my computer right now
@Pfhorrest
November 18, 2025 at 4:03 am
This entire discussion seems to ignore the critical role that framing plays in almost all visual art. Literally just choosing what aspect ratio to take a photo in, how far to zoom, and where to pan in the scene, can make all of the difference. When I first started taking pictures on my nature hikes, I treated the camera as a recording device for intrinsically beautiful things that I saw in nature, and was disappointed that the photos never captured the beauty of seeing the things in person. In time I realized that in person I was narrowing my attention and the focal depth of my eyes and the position of my head and so on to virtually frame the particular thing in the scene that was of interest to me, while my photos were just capturing the whole wide scene and assuming that since the pretty thing is in the scene, it's a pretty photo. It was only in time that I realized that by getting closer to the particular thing of interest, positioning it within the frame of the lens, orienting that frame in the most appropriate way, etc, could I capture the beauty that I was perceiving in person but not with a simple wide-view record of the scene.
Consider if a famous portrait painting were not framed how it were, but if instead that person was just one face in a crowd of irrelevant and less pleasing details on a much larger canvas. The actual detail of the famous, aesthetically pleasing painting would all still be present in the larger work, but it could easily on the whole be a worse work altogether because of the importance of framing.
@alexberezhniy8001
November 18, 2025 at 4:03 am
Hey, how about all sorts of creative photography? A.E. Light-painting, collages, double exposure, using mirrors, reflectors etc. don’t you as a photographer, say, in studio, have complete control over the way the object looks? Great channel btw)
@catcatcatcatcatcatcatcatcatca
November 18, 2025 at 4:03 am
I am a little late for the comments, but a question for any future viewers: isn't paintings aestetics purely causal too? The painter can mess with the paint and choose where to put it, but at the end of the day, we can only see the paint and canvas. How is choosing what paint goes where fundamentally different from photography? Snapshots and bad photography is just paint that was put on the canvas not so precisely.
@shadetreader
November 18, 2025 at 4:03 am
I think the whole notion that the internet is somehow less real or meaningful is quite classist and ableist. For varying combinations of reasons, most people in the world don’t realistically have the option of going to a play or a concert or a museum whenever we feel like it, so we can’t have what more privileged people would consider to be ”proper” (or even ”real”) aesthetic experiences.
@zacharysimonson2551
November 18, 2025 at 4:03 am
Is there value in thinking of a photo as painting with a particular type of medium. Rather than oil paint or watercolors the photographer uses photons and film or photos and digital manipulation to make a painting.
@justabitofamug6989
November 18, 2025 at 4:03 am
Lmao my paintings never look like how I intend them to
@testosteronic
November 18, 2025 at 4:03 am
I feel like the answer to 'can aesthetic be appreciated through the internet?' is watch Contrapoints
@AudioPervert1
November 18, 2025 at 4:03 am
instagram is trash .. a limitless sea of digital trash of humanity floating around for millions of hapless like hungry users .. its full of f**K all ads and propaganda now .. already destroyed from within …
@alienfortytwo
November 18, 2025 at 4:03 am
Aren't the object of a photo is just another tool? Like camera is a tool, but your face is also a tool you are using to achieve the end product – selfie. Or a kitten, or sunset, you get the point.
@flameking2178
November 18, 2025 at 4:03 am
3:11 Even paint drying?
@angelmints
November 18, 2025 at 4:03 am
This is a really sweet video! I’ve watched many of your recent ones but I’m glad I’ve come across this now 😀
@12bestskater12
November 18, 2025 at 4:03 am
Can you apply scrutins argument about intentions with paintings onto music?? and do you know any sources regarding this argument but applied to music??
@jaybretherton6246
November 18, 2025 at 4:03 am
You and Mike are so cute
@Amy-zb6ph
November 18, 2025 at 4:03 am
I think photography is aesthetically relevant and that it is art because you are stepping into the perspective of the photographer. We could all go into a bar and look at the bottles on the shelf but each of us is going to see something slightly different. When someone takes a photo of what they see to be the most beautiful angle with the settings on their camera (or filters in Instagram) that they think look the best, we are all able to see into their vision of the rows of bottles. In a painting, we also see the painter's vision, even if it's of something that doesn't exist in the real world. Both forms of art are ways to see into another person's mind. I see photography as a form of art that anyone can do too and I think that also makes it really valuable.
@badasunicorn6870
November 18, 2025 at 4:03 am
What if both photographs and paintings of real life people and things are in fact not the made by an arttist inspired by the subject, but the subject expressing itself inspired by the painter photographer…
@Saint_nobody
November 18, 2025 at 4:03 am
#PicsArt
@weresmygun
November 18, 2025 at 4:03 am
Angry photographers below, beware.
@valentina711
November 18, 2025 at 4:03 am
the celestial bodies are the subject, and the subject is beautiful itself, the photo is just a record of this. There is no talent of the photographer there, im sorry. Just technology and the universe´s beatiness. I think you can do better…
@kaitlyn__L
November 18, 2025 at 4:03 am
another example i like to think of, like the infrared photography, is long exposure photography. those streaks of lights the aggregate of everything going past the camera while it was looking. it also appeals to me how with common subject matter, like a city street or a motorway, it's very difficult to control the outcome beyond just what you did ot make it possible, that organic aspect to it. it's almost a collaborative participation, just by driving or walking past.
@GodofWhim
November 18, 2025 at 4:03 am
I'm subscribed to NerdSync, you, Ideachannel, and Extracredits. Any others I should add for this sort of content?
@SirRoundsoundRecords
November 18, 2025 at 4:03 am
Are books aesthetically pointless as well? Cause a picture is more then a thousand words..
@martinreid2352
November 18, 2025 at 4:03 am
So for Scruton, a photo is strictly that which records its subject, and so he agrees with the Transparency Thesis?
@himbo.genius
November 18, 2025 at 4:03 am
please never say dibbly doo ever again.
@satanarchyb7824
November 18, 2025 at 4:03 am
I really liked this video, maybe you could do a video about how fashion is or isn't an artform?
@henrikegym
November 18, 2025 at 4:03 am
https://www.instagram.com/henrike_cr7/
@giascle
November 18, 2025 at 4:03 am
Good video, but I think you're still simplifying the art of photography; you implied it has aesthetic significance largely due to the filters put on it, which of course doesn't apply to most photographs.
You are making artistic choices from the moment you decide to even take a picture. You chose this subject due to its inherent aesthetic qualities, but how you choose to frame it is what gives it meaning. To use one of Ken Van Sickle's photos as an example, the arch and the lamppost in this image are of similar sizes, and the perspective on the top of the arch creates a diagonal line right to the post. He has created a connection between the two, and if he had just turned a few degrees to the left, the lamppost would be out of the shot, and the stronger connection would be between the arch and the tree, which at the moment are treated more as one form. He might have just captured what was already there, but HOW he captured it created something new.
http://static1.squarespace.com/static/54d1018be4b032ab36c1934b/54e8e66ce4b05860a46b6871/54e8e685e4b021b682c0f95e/1425350562128/Washington%2BSquare%2BSnow.jpg
And this is not even touching on the blurry line between photography and painting. There are many artists who can paint so realistically, you'd think it's a photo unless told otherwise. In these cases, they're pretty much always basing it on a photo, so the painting has aesthetic worth but the photograph doesn't? (Not saying you believe this; just a point I think you forgot.)
Comments are closed.